Back to MOLECULAR BASIS OF INHERITANCE

Your Progress

0 / 388 Answered

Correct

Incorrect

Accuracy

NEET • BIOLOGY • MOLECULAR BASIS OF INHERITANCE

Molecular basis of inheritance practice · Mixed difficulty

Choose an answer to check it, or open “View answer” to study the explanation. Sign in to save progress to your account.

Practice format and chapter quiz

The practice player uses single-correct-answer MCQs. Chapter quizzes help you review a topic; they are not full-length NEET mock papers.

Take a chapter quiz →

Showing 61-90 of 388 questions

Preparing practice and saved progress…

61 Hard

61 of 388

Remembering +4 | -1

m RNA is located in the?

View answer and explanation

Correct option: A

Small subunit of Ribosome

Option A (Small subunit of Ribosome) is correct because mRNA binds to the small subunit of the ribosome during translation.

62 Medium

62 of 388

Remembering +4 | -1

Operon concept was proposed by?

View answer and explanation

Correct option: A

Jacob – Monod

Option A is correct because the operon concept, which explains gene regulation in prokaryotes, was proposed by Jacob and Monod.

63 Easy

63 of 388

Understanding +4 | -1

NHCs protein involve in _____ process.

View answer and explanation

Correct option: C

Higher level packaging in eukaryotes

Option C (Higher level packaging in eukaryotes) is correct because NHCs (Non-Histone Chromosomal) proteins are involved in the further packaging of DNA in eukaryotes, beyond the nucleosome level.

64 Medium

64 of 388

Remembering +4 | -1

Mutations are induced by

View answer and explanation

Correct option: D

All of these

Option D (All of these) is correct because X-rays, UV rays, and γ-rays are all known mutagens that can induce mutations.

65 Medium

65 of 388

Understanding +4 | -1

Escherichia coli fully labelled with

^{15}N

is allowed to grow in

^{14}N

medium. The two strands of DNA molecule of the first generation bacteria have

View answer and explanation

Correct option: A

Different density and do not resemble with their parent DNA

Option A (Different density and do not resemble with their parent DNA) is correct because, after one generation, each DNA molecule consists of one heavy

^{15}N

strand and one light

^{14}N

strand, resulting in a hybrid density and not resembling the original fully

^{15}N

DNA.

66 Medium

66 of 388

Analyzing +4 | -1

Assertion (A): DNA is chemically less reactive as compare to RNA.

Reason (R): Few RNA have the ability of catalysis.

View answer and explanation

Correct option: B

Both (A) & (R) are true but the (R) is not the correct explanation of the (A)

Option B is correct because both statements are true, but the ability of some RNAs to act as catalysts (ribozymes) doesn't explain why DNA is chemically less reactive.

67 Hard

67 of 388

Understanding +4 | -1

Mark the correct statement.

View answer and explanation

Correct option: B

mRNA is polycistronic in prokaryotes and monocistronic in eukaryotes

Option B (mRNA is polycistronic in prokaryotes and monocistronic in eukaryotes) is correct because prokaryotic mRNA can code for multiple proteins (polycistronic), while eukaryotic mRNA typically codes for only one protein (monocistronic).

68 Easy

68 of 388

Remembering +4 | -1

Number of carbons in ring of deoxyribose sugar is

View answer and explanation

Correct option: B

Five

Option B (Five) is correct because deoxyribose is a pentose sugar, meaning it has five carbon atoms in its ring structure.

69 Medium

69 of 388

Understanding +4 | -1

The following ratio is generally constant for a given species

View answer and explanation

Correct option: C

G+C/A+T

Option D is correct because the ratio of (G+C)/(A+T) is generally constant for a given species, reflecting the stability of the DNA molecule due to the specific base pairing.

70 Medium

70 of 388

Analyzing +4 | -1

If DNA contained sulphur instead of phosphorus
and proteins contained phosphorus instead of
sulphur, what would have been the outcome of
Hershey and Chase experiment?

View answer and explanation

Correct option: D

Radioactive sulphur in bacterial cells

Option D (Radioactive sulphur in bacterial cells) is correct because if DNA contained sulfur instead of phosphorus, the radioactive sulfur would be found in the bacterial cells after infection.

71 Medium

71 of 388

Remembering +4 | -1

Which of the character is not applicable to

t

RNA?

View answer and explanation

Correct option: D

It is the largest of the RNAs

Option D (It is the largest of the RNAs) is correct because tRNA is the smallest of the RNAs, not the largest.

72 Easy

72 of 388

Understanding +4 | -1

Which of the following is in correct w.r.t nucleosides?

View answer and explanation

Correct option: A

Cytosine

Option A (Cytosine) is correct because Cytosine is a nitrogenous base, not a nucleoside. Guanosine, Adenosine, and Uridine are nucleosides.

73 Medium

73 of 388

Remembering +4 | -1

A nucleoside is

View answer and explanation

Correct option: B

Purine/pyrimidine+sugar

Option B (Purine/pyrimidine+sugar) is correct because a nucleoside consists of a nitrogenous base (purine or pyrimidine) attached to a sugar molecule (ribose or deoxyribose).

74 Hard

74 of 388

Remembering +4 | -1

How many different proteins does the ribosome consist of?

View answer and explanation

Correct option: C

Option C is correct because the ribosome consists of approximately 80 different proteins.

75 Medium

75 of 388

Application +4 | -1

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'

View answer and explanation

Correct option: D

5’AUGUACCGUUUAUAGGUAAGU3’

Option D (5’AUGUACCGUUUAUAGGUAAGU3’) is correct because DNA dependent RNA polymerase reads the DNA template in the 3' to 5' direction and synthesizes the RNA transcript in the 5' to 3' direction, using complementary base pairing (A with U, T with A, C with G, and G with C).

Explore Other Chapters in BIOLOGY

View All →

ANIMAL KINGDOM 756 MCQs PLANT KINGDOM 415 MCQs ANATOMY OF FLOWERING PLANTS 404 MCQs CHEMICAL COORDINATION AND INTEGRATION 387 MCQs PRINCIPLE OF INHERITANCE AND VARIATION 374 MCQs EVOLUTION 362 MCQs

76 Easy

76 of 388

Remembering +4 | -1

The first genetic material was

View answer and explanation

Correct option: A

RNA

Option A (RNA) is correct because RNA has both genetic and catalytic properties, making it a likely candidate for the first genetic material.

77 Medium

77 of 388

Application +4 | -1

If a double–stranded DNA has 30% of guanine, what will be the percentage of adenine and thymine base pairs?

View answer and explanation

Correct option: C

0.4

Option A (0.4) is correct because in double-stranded DNA, the amount of guanine (G) equals cytosine (C), and adenine (A) equals thymine (T). If G is 30%, then C is 30%, leaving 40% for A and T combined, so A = T = 20%. Thus, the percentage of adenine and thymine base pairs is 0.4.

78 Medium

78 of 388

Application +4 | -1

The mRNA consisting of 282 nucleotides can produce a polypeptide chain of

View answer and explanation

Correct option: C

93 amino acids

Option D (94 amino acids) is incorrect. The correct answer is 93 amino acids because the mRNA consists of 282 nucleotides, and each codon consists of 3 nucleotides. Therefore, 282 / 3 = 94 codons. However, one codon is a stop codon, so 94 - 1 = 93 amino acids.

79 Medium

79 of 388

Remembering +4 | -1

Which of the following responsible for terminating translation and releasing the complete polypeptide from the ribosome :

View answer and explanation

Correct option: A

Release factor

Option A is correct because release factors recognize stop codons in the mRNA and trigger the release of the polypeptide chain from the ribosome, terminating translation.

80 Hard

80 of 388

Understanding +4 | -1

Which of the following steps in transcription is catalysed by RNA polymerase?

View answer and explanation

Correct option: B

Elongation

Option B (Elongation) is correct because RNA polymerase's primary function during transcription is to catalyze the addition of nucleotides to the growing mRNA strand during the elongation phase.

81 Hard

81 of 388

Understanding +4 | -1

The promoter site and the terminator site for transcription are located at

View answer and explanation

Correct option: B

5'

(up stream) end and

3'

(down stream) end, respectively of the transcription unit

Option B (

5'

(up stream) end and

3'

(down stream) end, respectively of the transcription unit) is correct because the promoter is located upstream of the transcription start site (

5'

end), and the terminator is located downstream of the transcription end site (

3'

end).

82 Medium

82 of 388

Remembering +4 | -1

DNA strand which is formed continuously in 5’

\to

3’ direction is called

View answer and explanation

Correct option: B

Leading strand

Option B (Leading strand) is correct because the leading strand is synthesized continuously in the 5' to 3' direction during DNA replication.

83 Hard

83 of 388

Analyzing +4 | -1

There are three genes a, b, c. Percentage of crossing over between a and b is 20%, b and c is 28% and a and c is 8%. What is the sequence of genes on chromosome?

View answer and explanation

Correct option: A

b, a, c

Option A (b, a, c) is correct because the gene sequence is determined by the percentage of crossing over, with the largest percentage between the farthest genes. Therefore, 'b' and 'c' are farthest apart, and 'a' lies in between.

84 Medium

84 of 388

Understanding +4 | -1

If the nucleus of a frog egg is destroyed and replaced with the nucleus of an intestinal cell from a tadpole, the egg can develop into a normal tadpole. This demonstrates that:

View answer and explanation

Correct option: C

An intestinal cell possesses a full set of genes

Option C (An intestinal cell possesses a full set of genes) is correct because the ability of the intestinal cell nucleus to direct the development of a normal tadpole demonstrates that it contains all the genetic information necessary for development.

85 Medium

85 of 388

Understanding +4 | -1

Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?

View answer and explanation

Correct option: C

Genetic code is nearly universal

Option C (Genetic code is nearly universal) is correct because the near-universality of the genetic code allows bacteria to produce human proteins.

86 Easy

86 of 388

Remembering +4 | -1

There are …… type of RNA polymerase in E. coli while …… type in human cell:-

View answer and explanation

Correct option: C

1, 3

Option C (1, 3) is correct because E. coli has one type of RNA polymerase, while human cells have three types (RNA polymerase I, II, and III).

87 Hard

87 of 388

Understanding +4 | -1

Select the enzymes required during process of replication of

DNA

.

a. Helicase

b. Topoisomerase

c.

DNA

dependent

RNA

polymerase

d.

DNA

dependent

DNA

polymerase

e. Ligase

f. Primase

g. Peptidyl transferase

h. Translocase

View answer and explanation

Correct option: D

All except g and

h

Option D is correct because peptidyl transferase and translocase are involved in protein synthesis (translation), not DNA replication.

88 Easy

88 of 388

Understanding +4 | -1

Transcription is chemically and enzymatically similar to

DNA

replication. But the below given statements which differ transcription from

DNA

replication, are

(a) New strand is made form ribonucleotides

(b) The

RNA

product does not remain base paired to the template

DNA

(c)

RNA

polymerase does not need primer

(d) Helicase is required for local unwinding of

DNA

strands during transcription

View answer and explanation

Correct option: D

(a), (b) and (c)

Option D ((a), (b) and (c)) is correct because transcription uses ribonucleotides, the RNA product doesn't remain base-paired, and RNA polymerase doesn't need a primer, which are all differences from DNA replication. Helicase is not always required for transcription.

89 Medium

89 of 388

Understanding +4 | -1

How does polymorphism arise?

View answer and explanation

Correct option: A

Mutations

Option A (Mutations) is correct because polymorphism arises primarily due to mutations in the DNA sequence.

90 Easy

90 of 388

Understanding +4 | -1

RNA cannot act as genetic material as it

View answer and explanation

Correct option: B

Mutate at a faster rate

Option B (Mutate at a faster rate) is correct because RNA is less stable than DNA and has a higher mutation rate due to the presence of ribose sugar and uracil instead of thymine.

Revision notes and key takeaways

Review MOLECULAR BASIS OF INHERITANCE in your textbook or class notes, then use this set to check your understanding.

Showing 61-90 of 388 questions

Your Progress

Molecular basis of inheritance practice · Mixed difficulty

Explore Other Chapters in BIOLOGY

Continue Your Practice

Your practice