Back to MOLECULAR BASIS OF INHERITANCE

Your Progress

0 / 388 Answered

Correct

Incorrect

Accuracy

NEET • BIOLOGY • MOLECULAR BASIS OF INHERITANCE

Molecular basis of inheritance practice · Mixed difficulty

Choose an answer to check it, or open “View answer” to study the explanation. Sign in to save progress to your account.

Practice format and chapter quiz

The practice player uses single-correct-answer MCQs. Chapter quizzes help you review a topic; they are not full-length NEET mock papers.

Take a chapter quiz →

Showing 271-300 of 388 questions

Preparing practice and saved progress…

271 Medium

271 of 388

Remembering +4 | -1

The human genome contains _________

View answer and explanation

Correct option: C

3164.7 Million BP

Option C (3164.7 Million BP) is correct because the human genome contains approximately 3.1647 billion base pairs, which is 3164.7 million base pairs.

272 Easy

272 of 388

Remembering +4 | -1

Select the odd one w.r.t stop codons.

View answer and explanation

Correct option: A

AUG

Option A (AUG) is correct because AUG is the start codon, while the others are stop codons.

273 Medium

273 of 388

Understanding +4 | -1

Now a days it is possible to detect the mutated gene causing cancer by allowing radioactive probe to hybridize its complimentary DNA in a clone of cells, followed by its detection using autoradiography because:

View answer and explanation

Correct option: A

Mutated gene does not appear on a photographic film as the probe has no complementary with it

Option A (Mutated gene does not appear on a photographic film as the probe has no complementary with it) is correct because a mutated gene will not hybridize with a complementary probe, thus not appearing on the film.

274 Easy

274 of 388

Remembering +4 | -1

The enzyme DNA polymerase was discovered by

View answer and explanation

Correct option: A

Kornberg

Option A (Kornberg) is correct because Arthur Kornberg discovered DNA polymerase in 1956.

275 Medium

275 of 388

Remembering +4 | -1

‘It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material’. This is written by

View answer and explanation

Correct option: D

Watson and Crick

Option D (Watson and Crick) is correct because they proposed the double helix structure of DNA and its copying mechanism.

276 Hard

276 of 388

Remembering +4 | -1

Which of the following codons codes for glycine and leucine respectively?

View answer and explanation

Correct option: A

GGU and CUU

Option A (GGU and CUU) is correct because GGU codes for glycine and CUU codes for leucine.

277 Medium

277 of 388

Understanding +4 | -1

Which of the following radioisotope is not suitable for DNA labeling based studies?

View answer and explanation

Correct option: D

{\mathrm{S}^{35}}

Option D (

{\mathrm{S}^{35}}

) is the correct answer because sulfur is not a component of DNA, while hydrogen, phosphorus, and nitrogen are.

278 Hard

278 of 388

Remembering +4 | -1

The genetic instructions for forming a polypeptide chain are carried to the ribosome by the

View answer and explanation

Correct option: B

mRNA

Option B (mRNA) is correct because mRNA carries the genetic instructions for polypeptide chain formation from DNA to the ribosome.

279 Easy

279 of 388

Remembering +4 | -1

Which was the last human chromosome to be compeletely
sequenced?

View answer and explanation

Correct option: A

chromosome 1

Option A (chromosome 1) is correct because chromosome 1 was the last human chromosome to be completely sequenced.

280 Medium

280 of 388

Understanding +4 | -1

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA?

View answer and explanation

Correct option: A

A polypeptides of 24 amino acids will be formed.

Option A (A polypeptides of 24 amino acids will be formed) is correct because the UAA codon is a stop codon, and translation will terminate prematurely at the 25th codon position.

281 Medium

281 of 388

Analyzing +4 | -1

Assertion: When the DNA sequences of two
people are cut using the same restriction enzyme,
the length and number of fragments obtained
are different for both.

Reason: DNA sequence is arranged tandemly
in many copy numbers which varies from
chromosome to chromosome in an individual,
showing high degree of polymorphism.

View answer and explanation

Correct option: A

If both Assertion and Reason are true and
Reason is the correct explanation of Assertion

Option A is correct because both the assertion and reason are true, and the reason correctly explains why the fragment lengths differ after restriction enzyme digestion.

282 Medium

282 of 388

Understanding +4 | -1

Identify an incorrect match:

View answer and explanation

Correct option: C

Discontinuous synthesis of DNA : On template 3' → 5'

Option C is correct because discontinuous synthesis occurs on the template with 5' to 3' polarity, not 3' to 5'.

283 Easy

283 of 388

Remembering +4 | -1

RNA has uracil instead of

View answer and explanation

Correct option: C

Thymine

Option C (Thymine) is correct because in RNA, Uracil replaces Thymine as one of the four nitrogenous bases.

284 Medium

284 of 388

Remembering +4 | -1

The scientist who was awarded Nobel-Prize in 1959 for

in\mathrm{ }vitro

synthesis of polyribonucleotide?

View answer and explanation

Correct option: D

Ochoa

Option D (Ochoa) is correct because Severo Ochoa received the Nobel Prize in 1959 for his work on the enzymatic synthesis of RNA.

285 Medium

285 of 388

Understanding +4 | -1

Synthesis of DNA from RNA is explained by?

View answer and explanation

Correct option: D

All of these

Option D (All of these) is correct because the synthesis of DNA from RNA is described as reverse transcription, which is a reversal of the central dogma, and is also known as Teminism.

Explore Other Chapters in BIOLOGY

View All →

ANIMAL KINGDOM 756 MCQs PLANT KINGDOM 415 MCQs ANATOMY OF FLOWERING PLANTS 404 MCQs CHEMICAL COORDINATION AND INTEGRATION 387 MCQs PRINCIPLE OF INHERITANCE AND VARIATION 374 MCQs EVOLUTION 362 MCQs

286 Easy

286 of 388

Understanding +4 | -1

DNA fingerprinting is a technique used in generating a profile of an individual. This technique identifies the various satellite DNA found in the sequence and has high degree of

View answer and explanation

Correct option: B

Polymorphism

Option B (Polymorphism) is correct because DNA fingerprinting exploits the high degree of polymorphism in satellite DNA sequences.

287 Easy

287 of 388

Application +4 | -1

In DNA of certain organisms, guanine constitutes 20% of the bases. What percentage of the bases would be adenine?

View answer and explanation

Correct option: D

0.3

Option D is correct. If guanine constitutes 20% of the bases, cytosine also constitutes 20%. Therefore, adenine and thymine together make up 60%, and adenine is 30%.

288 Hard

288 of 388

Understanding +4 | -1

Determination of one amino acid by more than one codon is due to

View answer and explanation

Correct option: A

Redundancy of genetic code

Option A (Redundancy of genetic code) is correct because the redundancy of the genetic code means that more than one codon can specify the same amino acid.

289 Medium

289 of 388

Remembering +4 | -1

Length of haploid content of human DNA

View answer and explanation

Correct option: D

3.3 \times {10^9}bp \times 3.4\,\,{A^0}

Option D (

3.3 \times {10^9}bp \times 3.4\\,{A^0}

) is correct because it represents the approximate length of the haploid content of human DNA.

290 Medium

290 of 388

Application +4 | -1

Which is correct sequence of amino acids that is translated by given mRNA - 5' AUGGUGUGGACC 3'?

View answer and explanation

Correct option: A

met - Val - trp – Thr

Option A (met - Val - trp – Thr) is correct because the mRNA sequence 5' AUGGUGUGGACC 3' translates to Met-Val-Trp-Thr.

291 Medium

291 of 388

Application +4 | -1

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

View answer and explanation

Correct option: A

T:30; G:20; C:20

Option A (T:30; G:20; C:20) is correct because in DNA, A=T and G=C. If Adenine is 30%, Thymine is also 30%. The remaining 40% is split equally between Guanine and Cytosine.

292 Medium

292 of 388

Understanding +4 | -1

Adenosine monophosphate is a

View answer and explanation

Correct option: D

Nucleotide of RNA

Option D (Nucleotide of RNA) is correct because adenosine monophosphate (AMP) is a nucleotide containing adenine, ribose (sugar found in RNA), and a phosphate group.

293 Easy

293 of 388

Remembering +4 | -1

In HGP, the sequence of which chromosome was completed in May 2006?

View answer and explanation

Correct option: B

Chromosome 1

Option B (Chromosome 1) is correct because the sequence of Chromosome 1 was completed in May 2006 as part of the Human Genome Project.

294 Medium

294 of 388

Remembering +4 | -1

Translation in eukaryotes occurs?

View answer and explanation

Correct option: B

On the ribosomes

Option B is correct because translation in eukaryotes occurs on the ribosomes.

295 Medium

295 of 388

Application +4 | -1

The given nucleotide sequence on mRNA is as shown below 5'AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3'

A) How many amino acids will be inserted in a polypeptide chain under normal conditions

B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA?

View answer and explanation

Correct option: B

(A) 4 , (B) 7

Option D ((A) 5 (B) 7) is correct because under normal conditions, 5 amino acids are inserted, and with the deletion, 7 amino acids are inserted.

296 Easy

296 of 388

Remembering +4 | -1

Find the correct combination, that can form a nucleotide of RNA.

View answer and explanation

Correct option: D

Uracil + ribose + phosphate

Option D (Uracil + ribose + phosphate) is correct because RNA contains uracil as a nitrogenous base, ribose as the sugar, and phosphate group.

297 Easy

297 of 388

Remembering +4 | -1

According to HGP, Y-chromosome in human
beings has least number of genes, the value is

View answer and explanation

Correct option: C

231

Option C (231) is correct because the Y-chromosome in humans has the least number of genes, approximately 231.

298 Hard

298 of 388

Understanding +4 | -1

Assertion: Chargaff rule is applicable to RNA.

Reason: RNA is a double standard molecule.

View answer and explanation

Correct option: D

If both the assertion and reason are false

Option D is correct because Chargaff's rule applies to double-stranded DNA, not RNA, and RNA is typically single-stranded.

299 Medium

299 of 388

Remembering +4 | -1

Which of the following is not a stop codon ?

View answer and explanation

Correct option: C

AUG

Option C (AUG) is correct because AUG is the start codon, while UAA, UAG, and UGA are stop codons.

300 Medium

300 of 388

Analyzing +4 | -1

Assertion : A number of different polypeptide
chains can be formed from a single mRNA
strand.

Reason : The mRNA strand has terminator
codons.

View answer and explanation

Correct option: B

If both Assertion and Reason are true but Reason
is not the correct explanation of Assertion

Option B is correct because both the assertion and the reason are true, but the reason does not explain the assertion. Different polypeptide chains can be formed from a single mRNA due to alternative splicing and the presence of multiple start codons, not just terminator codons.

Revision notes and key takeaways

Review MOLECULAR BASIS OF INHERITANCE in your textbook or class notes, then use this set to check your understanding.

Showing 271-300 of 388 questions

Your Progress

Molecular basis of inheritance practice · Mixed difficulty

Explore Other Chapters in BIOLOGY

Continue Your Practice

Your practice