Biotechnology-principles and processes practice · Mixed difficulty

During insertional inactivation, the presence of a chromogenic substrate gives blue coloured colonies if the plasmid in the bacteria does not have an insert. The blue colour is produced by the enzyme

Read the following and choose the correct statements
A) First recombinant DNA-Plasmid isolated from Salmonella and tagged with antibiotic resistant gene and cultured in E.coli.
B) EcoRI - It recognises a palindrome with 6 base pairs and 14 hydrogen bonds.
C) pBR 322 - 8 restriction sites for eight types of restriction enzymes, two types of genes for antibiotic resistance, one for gene replication of plasmid (Ori)
D) Copy number - Ori gene that supports the production of more DNA copies

Manipulation of DNA in genetic engineering become easy due to invention of

Genetic engineering is possible because

A plasmid

If the gene of interest is ligated at Lac-Z gene in pUC8 vector, then

The sequence that controls the copy number of the linked DNA in the vector, is termed

EcoRI cuts the DNA between bases ‘X’ and ‘Y’ only when the sequence 5’ – GAATTC – 3’ is present in the DNA. These two bases form how many $H_2$ bonds, respectively, with their complementary $N_2$ bases?

Which of the following are used to gene cloning?

A suitable vector for gene cloning in higher organisms is

Assertion: A bacterial cell with no restriction enzymes will be easily infected and lysed by bacteriophages.
Reason: Restriciton enymes catalyse synthesis of protective coat around bacterial cell that prevents bacteriophage attack.

In the vector pBR322, restriction site of Pvu II is present in

An extrachromosomal DNA, which can be used as vector in gene cloning is called

The molecular action of UV light is mainly reflected through

What is true for plasmid?

Which of the following key factors, makes plasmid, the vector in genetic engineering?

How many fragments are formed when the above DNA fragment is treated with ECoRI?
$\begin{array}{l} {5^1}TTGGCTTAAGACGAATTCACGAATTCACACC{3^1}\\ {3^1}AACCGAATTCTGCTTAAGTGCTTAAGTGTGG{5^1} \end{array}$

Assertion: Recognition site should be preferably
single and responsive to commonly used
restriction enzyme.

Reason: In pBR322 alien DNA is ligated
generally in the area of Bam-HI site of
tetracycline resistance gene.

The function of polymerase chain reaction is

Which of the following is not a basis of difference between plasmid and chromosomal DNA?
a. Presence of histones
b. Nature of histones
c. Nature of nucleotides
d. Linear form of genetic material

A piece of Nucleic acid used to find out a gene by forming a hybrid with it is called.

How many fragments will be generated if you digest a linear DNA molecule with a restriction enzyme having four recognition sites on the DNA?

How many dsDNA molecules are obtained from one dsDNA after completion of 8 cycles of PCR?

Assertion: A single stranded DNA tagged with radioactive molecule is allowed to hydridise followed by autoradiography, the clone having the mutated gene does not appear.

Reason: The clone having the mutated gene does not appear on the photographic film as the probe used will not have complementarity with the mutated gene.

Arrange the following in the descending order of their number in restriction site of E.coRI
I. Number of hydrogen bonds broken
II. Number of covalent bonds broken
III. Total number of hydrogen bonds
IV. Number of hydrogen bonds left intact after treating with enzyme
V. Number of unpaired nucleotides left at each end of the fragment

If an isolated strain of DNA is kept at 80-90$^\circ$C, then,

Assertion: All expression vectors are cloning
vectors and vice versa.

Reason: Expression vectors have at least the
regulatory sequences i.e., promoters, operators,
ribosomal binding sites, etc. having optimum
function in the chosen control but not origin of
replication.

$Taq$ polymerase enzyme used in PCR is isolated from

Find the mismatch

The correct sequence of making a cell competent is