Histone proten- Positive charge

Back to BIOTECHNOLOGY-PRINCIPLES AND PROCESSES

Your Progress

0 / 41 Answered

Correct

Incorrect

Accuracy

NEET • BIOLOGY • BIOTECHNOLOGY-PRINCIPLES AND PROCESSES

Biotechnology-principles and processes practice · Medium

Try a question, then open “View answer” to check it. Sign in to submit answers and save progress.

Practice format and chapter quiz

The practice player uses single-correct-answer MCQs. Chapter quizzes help you review a topic; they are not full-length NEET mock papers.

Take a chapter quiz →

Showing 31-41 of 41 questions

31 Medium

31 of 41

Analyzing +4 | -1

How many fragments are formed when the above DNA fragment is treated with ECoRI?

\begin{array}{l} {5^1}TTGGCTTAAGACGAATTCACGAATTCACACC{3^1}\\ {3^1}AACCGAATTCTGCTTAAGTGCTTAAGTGTGG{5^1} \end{array}

View answer and explanation

Correct option: B

Option B (3) is correct because the EcoRI recognition sequence (GAATTC) appears twice in the given DNA fragment, resulting in three fragments after digestion.

32 Medium

32 of 41

Analyzing +4 | -1

Assertion: Recognition site should be preferably
single and responsive to commonly used
restriction enzyme.

Reason: In pBR322 alien DNA is ligated
generally in the area of Bam-HI site of
tetracycline resistance gene.

View answer and explanation

Correct option: B

If both Assertion and Reason are true but Reason
is not the correct explanation of Assertion

Option B is correct. Both the assertion and reason are true, but the reason is not the correct explanation of the assertion. The assertion is about the desirability of a single recognition site, and the reason is about where alien DNA is ligated in pBR322, which doesn't explain why a single site is preferred.

33 Medium

33 of 41

Remembering +4 | -1

The function of polymerase chain reaction is

View answer and explanation

Correct option: B

DNA amplification

Option B (DNA amplification) is correct because the primary function of PCR is to amplify specific DNA sequences.

34 Medium

34 of 41

Analyzing +4 | -1

Which of the following is not a basis of difference between plasmid and chromosomal DNA?
a. Presence of histones
b. Nature of histones
c. Nature of nucleotides
d. Linear form of genetic material

View answer and explanation

Correct option: A

\&

c only

Option B (a & d only) is correct because plasmids do not have histones, and chromosomal DNA is typically linear in eukaryotes (and circular in prokaryotes), while plasmids are circular.

35 Medium

35 of 41

Application +4 | -1

How many fragments will be generated if you digest a linear DNA molecule with a restriction enzyme having four recognition sites on the DNA?

View answer and explanation

Correct option: C

Option C (5) is correct because with four recognition sites on a linear DNA molecule, digestion will result in five fragments.

36 Medium

36 of 41

Understanding +4 | -1

How many dsDNA molecules are obtained from one dsDNA after completion of 8 cycles of PCR?

View answer and explanation

Correct option: B

256

Option B (256) is correct because each cycle of PCR doubles the number of DNA molecules, so after 8 cycles, one dsDNA molecule becomes 2⁸ = 256.

37 Medium

37 of 41

Analyzing +4 | -1

Assertion: A single stranded DNA tagged with radioactive molecule is allowed to hydridise followed by autoradiography, the clone having the mutated gene does not appear.

Reason: The clone having the mutated gene does not appear on the photographic film as the probe used will not have complementarity with the mutated gene.

View answer and explanation

Correct option: A

Both assertion and reason are true and reason is the correct explanation of assertion

Option A is correct. If the probe is complementary to the normal gene but not the mutated gene, it will not hybridize to the mutated gene, and no signal will appear on the autoradiograph.

38 Medium

38 of 41

Understanding +4 | -1

If an isolated strain of DNA is kept at 80-90

^\circ

C, then,

View answer and explanation

Correct option: D

It uncoils and the two strands separate

Option D is correct because heating DNA to 80-90°C causes denaturation, which separates the two strands due to the breaking of hydrogen bonds.

39 Medium

39 of 41

Analyzing +4 | -1

Find the mismatch

View answer and explanation

Correct option: A

Khorana-R.E.E

Option A (Khorana-R.E.E) is the mismatch because Khorana is known for his work on artificial synthesis of genes, not restriction enzymes (R.E.E).

40 Medium

40 of 41

Application +4 | -1

How many copies of DNA sample are produced in PCR technique after 6 cycles?

View answer and explanation

Correct option: D

Option D is correct. In PCR, the number of copies doubles with each cycle. After 6 cycles, starting with one copy, there will be 2⁶ = 64 copies.

41 Medium

41 of 41

Understanding +4 | -1

Which one of the following can help in the diagnosis of a genetical disorder?

View answer and explanation

Correct option: C

PCR

Option C (PCR) is correct because PCR can amplify specific DNA sequences, allowing for the detection of genetic mutations associated with disorders.

Revision notes and key takeaways

Review BIOTECHNOLOGY-PRINCIPLES AND PROCESSES in your textbook or class notes, then use this set to check your understanding.

Showing 31-41 of 41 questions

Continue Your Practice

📚 Switch Set (MEDIUM)

Chapter Sets

ALL 94 MCQs EASY 24 MCQs HARD 29 MCQs MEDIUM 41 MCQs

0 /41

0✓ 0✗

0% Accuracy